|  Help  |  About  |  Contact Us

Allele : Casp8<em1Ieb> caspase 8; endonuclease-mediated mutation 1, Igor Brodsky

Primary Identifier  MGI:6781292 Allele Type  Endonuclease-mediated
Gene  Casp8 Strain of Origin  (C57BL/6 x SJL)F1
Is Recombinase  false Is Wild Type  false
molecularNote  Aspartic acid codon 387 (GAT) was targeted for change to an alanine codon (GCC)(p.D387A) with an sgRNA (targeting ACAGAACCACACTTTAGAAG) and an ssODN template (TTGCCTCATCATCTCACAAGAACTATATTCCGGATGAGGCAGAT) using CRISPR/Cas9 technology. This mutation prevents autoprocessing of the encoded peptide.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Casp8<DA>,
  • Casp8<DA>,
  • Casp8<D387A>,
  • Casp8<D387A>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

9 Publication categories