| Primary Identifier | MGI:6781292 | Allele Type | Endonuclease-mediated |
| Gene | Casp8 | Strain of Origin | (C57BL/6 x SJL)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Aspartic acid codon 387 (GAT) was targeted for change to an alanine codon (GCC)(p.D387A) with an sgRNA (targeting ACAGAACCACACTTTAGAAG) and an ssODN template (TTGCCTCATCATCTCACAAGAACTATATTCCGGATGAGGCAGAT) using CRISPR/Cas9 technology. This mutation prevents autoprocessing of the encoded peptide. |
