| Primary Identifier | MGI:6764592 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Chmp1b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAACAGATGCTTCTCCATGT and GCCGTCAGACTTGATCCCGA, which resulted in a 583 bp deletion beginning at Chromosome 18 position 67,338,578 bp and ending after 67,339,160 bp (GRCm39/mm39). This mutation deletes 583 bp from ENSMUSE00001382908 (exon 1) and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 19 amino acids later. |
