| Primary Identifier | MGI:6758799 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp146 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAATGAGTATGGATTTTC and AGCCAGCAGAGAATCTTAAG, which resulted in an 855 bp deletion beginning at Chromosome 7 position 29,861,159 bp and ending after 29,862,013 bp (GRCm39/mm39). This mutation deletes 855 bp from ENSMUSE00000393840 (exon 2) and is predicted to cause a change of amino acid sequence after residue 9 and termination 17 amino acids later. There is a 1 bp insertion (C) at the deletion site. |