|  Help  |  About  |  Contact Us

Allele : Zfp146<em1(IMPC)J> zinc finger protein 146; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6758799 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp146
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAATGAGTATGGATTTTC and AGCCAGCAGAGAATCTTAAG, which resulted in an 855 bp deletion beginning at Chromosome 7 position 29,861,159 bp and ending after 29,862,013 bp (GRCm39/mm39). This mutation deletes 855 bp from ENSMUSE00000393840 (exon 2) and is predicted to cause a change of amino acid sequence after residue 9 and termination 17 amino acids later. There is a 1 bp insertion (C) at the deletion site.
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories