Primary Identifier | MGI:6758830 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Zfp541 |
Transmission | Germline | Strain of Origin | (129S2/SvPas x C57BL/6NSlc)F1-Tg(CAG-EGFP,Acr-EGFP)2Osb |
Is Recombinase | false | Is Wild Type | false |
molecularNote | Sequence upstream of exon 1 and in intron 8 were targeted with a pair of sgRNAs (targeting (1) TCCACTTCTCTAGTGCTAGG and (3) AGGCAGCTACACCACCCTCC), resulting in the deletion between sgRNA targets 1 and 3 containing exons 1-8. The ESCs used for the creation of this allele also contain the Tg(CAG-EGFP,Acr-EGFP)2Osb double transgene. |