|  Help  |  About  |  Contact Us

Allele : Lmod1<em1(IMPC)J> leiomodin 1 (smooth muscle); endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6794057 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Lmod1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTCGGTTGAGTTCTGTAG and TCCCAGAGCCAATTAGGCCT, which resulted in a 4824 bp deletion beginning at Chromosome 1 position 135,291,253 bp and ending after 135,296,076 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000396118 and ENSMUSE00000361252 (exons 2 and 3) and 1340 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 51 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories