| Primary Identifier | MGI:6794057 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Lmod1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTCGGTTGAGTTCTGTAG and TCCCAGAGCCAATTAGGCCT, which resulted in a 4824 bp deletion beginning at Chromosome 1 position 135,291,253 bp and ending after 135,296,076 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000396118 and ENSMUSE00000361252 (exons 2 and 3) and 1340 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 51 amino acids later. |