| Primary Identifier | MGI:6794069 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Elavl2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATACTGTATGACTCACAGAC and TTATGAAACCACACAGGCCC, which resulted in a 325 bp deletion beginning at Chromosome 4 position 91,169,372 bp and ending after 91,169,696 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001307484 (exon 3) and 221 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 61 amino acids later. |