| Primary Identifier | MGI:6802143 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Laptm4b |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 1 was targeted with an sgRNA (targeting CGCACCGGCACCATCCTGCTGG) using CRISPR/Cas9 technology, resulting in a 10 bp deletion (GCACCATCCT) that leads to a reading frame shift and premature stop codon (p.T25Wfs*6). |
