|  Help  |  About  |  Contact Us

Allele : Laptm4b<em1Huty> lysosomal-associated protein transmembrane 4B; endonuclease-mediated mutation 1, Huang-Tian Yang

Primary Identifier  MGI:6802143 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Laptm4b
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 1 was targeted with an sgRNA (targeting CGCACCGGCACCATCCTGCTGG) using CRISPR/Cas9 technology, resulting in a 10 bp deletion (GCACCATCCT) that leads to a reading frame shift and premature stop codon (p.T25Wfs*6).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • LAPTM4B<->,
  • LAPTM4B<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele