| Primary Identifier | MGI:6759775 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ttc17 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGATGTCTCTGATTAAGAGA and AGTCAAGTATAATCAAAGAC, which resulted in a 263 bp deletion beginning at Chromosome 2 position 94,206,259 bp and ending after 94,206,521 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001094860 (exon 6) and 153 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 221 and early truncation 2 amino acids later. |
