| Primary Identifier | MGI:6792078 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Ercc6l2 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Aspartic acid codon 270 (GAT) in exon 5 was targeted for change to asparagine (AAT)(p.D270N) with an sgRNA (targeting CTTCATAACTTCTGTAACTC) and an ssODN template using CRISPR/Cas9 technology. This mutation in the DEAH-box helicase catalytic site of the encoded peptide mimics one that is found in some inherited bone marrow failure (BMF) patients and renders the enzyme catalytic-dead. |
