|  Help  |  About  |  Contact Us

Allele : Maco1<em1(IMPC)J> macoilin 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6794036 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Maco1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAATATGTTGCTTGGCTTG and TTATAACCACTGCTTCCCCC, which resulted in a 505 bp deletion beginning at Chromosome 4 position 134,563,412 bp and ending after 134,563,916 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001289591 (exon 3) and 378 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 26 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories