| Primary Identifier | MGI:6794038 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp532 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTGGAGGGGTCTTCGTCT and CAGCACGCTGCAGACACCAG, which resulted in a 107 bp deletion beginning at Chromosome 18 position 65,758,287 bp and ending after 65,758,393 bp (GRCm39/mm39). This mutation deletes 107 bp of ENSMUSE00001378438 (exon 3) and is predicted to cause a change of amino acid sequence after residue 740 and early truncation 13 amino acids later. |
