| Primary Identifier | MGI:6864087 | Allele Type | Endonuclease-mediated |
| Attribute String | Reporter | Gene | Gt(ROSA)26Sor |
| Strain of Origin | B6.Cg-Gt(ROSA)26Sor<tm6(CAG-ZsGreen1)Hze>/J | Is Recombinase | false |
| Is Wild Type | false | Project Collection | CPMM |
| molecularNote | CRISPR/Cas9 genome editing removed the transcriptional stop cassette and flanking loxP sites in the existing Rosa-CAG-LSL-ZsGreen1-WPRE conditional allele using guides 5â AAAGAATTGATTTGATACCG (PAM CGG) and 5â GTATGCTATACGAAGTTATT (PAM AGG) to activate ZsGreen1 expression. Subsequently, CRISPR/Cas9 genome editing with a single-stranded DNA in mouse embryos from this seed line was used to introduce sequence harboring a guide target site and PAMs compatible with A.s. and L.b Cas12a, SauCas9, and SpyCas9 [5â TTTGTATGCTATACGAAGTTATTAGGAGT]. Introduction of this sequence disrupted the ZsGreen1 chromophore and introduced a premature stop codon, which disrupts ZsGreen1 expression and fluorescence. Homology-directed repair with a DNA donor can restore ZsGreen1 sequence, expression, and fluorescence. |
