|  Help  |  About  |  Contact Us

Allele : Gt(ROSA)26Sor<em3(CAG-ZsGreen1)Jahe> gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 3, Jason Heaney

Primary Identifier  MGI:6864087 Allele Type  Endonuclease-mediated
Attribute String  Reporter Gene  Gt(ROSA)26Sor
Strain of Origin  B6.Cg-Gt(ROSA)26Sor<tm6(CAG-ZsGreen1)Hze>/J Is Recombinase  false
Is Wild Type  false Project Collection  CPMM
molecularNote  CRISPR/Cas9 genome editing removed the transcriptional stop cassette and flanking loxP sites in the existing Rosa-CAG-LSL-ZsGreen1-WPRE conditional allele using guides 5’ AAAGAATTGATTTGATACCG (PAM CGG) and 5’ GTATGCTATACGAAGTTATT (PAM AGG) to activate ZsGreen1 expression. Subsequently, CRISPR/Cas9 genome editing with a single-stranded DNA in mouse embryos from this seed line was used to introduce sequence harboring a guide target site and PAMs compatible with A.s. and L.b Cas12a, SauCas9, and SpyCas9 [5’ TTTGTATGCTATACGAAGTTATTAGGAGT]. Introduction of this sequence disrupted the ZsGreen1 chromophore and introduced a premature stop codon, which disrupts ZsGreen1 expression and fluorescence. Homology-directed repair with a DNA donor can restore ZsGreen1 sequence, expression, and fluorescence.
  • mutations:
  • Insertion
  • synonyms:
  • Ai6-HDR1,
  • Ai6-HDR1
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele