|  Help  |  About  |  Contact Us

Allele : Cbln1os<em1Xis> cerebellin 1 precursor protein opposite strand; endonuclease-mediated mutation 1, Xiaoyuan Song

Primary Identifier  MGI:6798141 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cbln1os
Is Recombinase  false Is Wild Type  false
molecularNote  The first and last exons were targeted with sgRNAs (targeting TCCGGCCGGGAGTCAGACGA and AAGGGCATGGTGGGTTGGCG ) using CRISPR/Cas9 technology, resulting in a 52579 bp deletion encompassing most of the gene. Absence of transcription from this allele was confirmed by RT-qPCR.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Synage KO,
  • Synage KO
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories