| Primary Identifier | MGI:6798141 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cbln1os |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The first and last exons were targeted with sgRNAs (targeting TCCGGCCGGGAGTCAGACGA and AAGGGCATGGTGGGTTGGCG ) using CRISPR/Cas9 technology, resulting in a 52579 bp deletion encompassing most of the gene. Absence of transcription from this allele was confirmed by RT-qPCR. |
