|  Help  |  About  |  Contact Us

Allele : Arhgap45<em1Ciphe> Rho GTPase activating protein 45; endonuclease-mediated mutation 1, Centre d'ImmunoPhenomique

Primary Identifier  MGI:6806175 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Arhgap45
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Introns 3 and 4 were targeted with two sgRNAs (targeting AAGAGGGGATCTCTGTCGTGGGG and CAGAGTGGAGTTCGGGAGTATGG) using CRISPR/Cas9 technology, resulting in the deletion of exon 4. Lack of peptide expression in T and B cells was experimentally confirmed.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Arhgap45<tm1Ciphe>,
  • Arhgap45<->,
  • Arhgap45<->,
  • Arhgap45<tm1Ciphe>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories