| Primary Identifier | MGI:6806175 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Arhgap45 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Introns 3 and 4 were targeted with two sgRNAs (targeting AAGAGGGGATCTCTGTCGTGGGG and CAGAGTGGAGTTCGGGAGTATGG) using CRISPR/Cas9 technology, resulting in the deletion of exon 4. Lack of peptide expression in T and B cells was experimentally confirmed. |
