|  Help  |  About  |  Contact Us

Allele : Elovl2<em1Haml> ELOVL fatty acid elongase 2; endonuclease-mediated mutation 1, Bruce Hamilton

Primary Identifier  MGI:6782853 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Elovl2
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Cysteine codon 234 (TGT) was targeted for change to a tryptophan codon (TGG)(p.C234W) with an sgRNA (targeting GTCTTCCTATATGATGACGC) and an ssODN template (TTTCCCTTCGGCTGGCTCATCTTCCAGTCTTCCTATATGATGACGTTAGTC). The mutation selectively abolishes the enzymatic activity needed to process C22 polyunsaturated fatty acids, while leaving other enzymatic activity intact.
  • mutations:
  • Single point mutation
  • synonyms:
  • Elovl2<C234W>,
  • Elovl2<C234W>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories