|  Help  |  About  |  Contact Us

Allele : Atg7<em1Lutzy> autophagy related 7; endonuclease-mediated mutation 1, Cathy Lutz

Primary Identifier  MGI:6864524 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready Gene  Atg7
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 genome editing used crRNAs to insert loxP sites upstream (GCTCATTCCCATAATGAACC; CCCCCCGCCAGGTTCATTAT) and downstream (TAACAGTAACCACACCAACA; GTTTCTCTGCCATGTTGGTG) regions of exon 5 (ENSEMBL Transcript ID: ENSMUSE00001222215).
  • mutations:
  • Insertion
  • synonyms:
  • Atg7 cKO,
  • Atg7 cKO
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories