|  Help  |  About  |  Contact Us

Allele : Kif1a<em8Lutzy> kinesin family member 1A; endonuclease-mediated mutation 8, Cathy Lutz

Primary Identifier  MGI:6865775 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready Gene  Kif1a
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 genome editing uses guide RNAs (GTGAGTCCATCCCAATGAGA, CTTTGCCCCTCTCATTGGGA, ACTCTGCCCTAATCACCTGA, and TCAACTCAGAGTGACCCTTC) to target exon 3. Donor DNAs including loxP sites were created 160 bp upstream of exon 3 and 120 bp downstream of exon 3. LoxP insertion sites are separated by 363bp.
  • mutations:
  • Insertion
  • synonyms:
  • Kif1a cKO,
  • Kif1a cKO
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories