| Primary Identifier | MGI:6865775 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready | Gene | Kif1a |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 genome editing uses guide RNAs (GTGAGTCCATCCCAATGAGA, CTTTGCCCCTCTCATTGGGA, ACTCTGCCCTAATCACCTGA, and TCAACTCAGAGTGACCCTTC) to target exon 3. Donor DNAs including loxP sites were created 160 bp upstream of exon 3 and 120 bp downstream of exon 3. LoxP insertion sites are separated by 363bp. |
