|  Help  |  About  |  Contact Us

Allele : Dmwd<em1(IMPC)J> dystrophia myotonica-containing WD repeat motif; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6849816 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dmwd
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCGTAGCCAACCAAACGCGA and TCTCGACCCCCAAAGTCAAG, which resulted in a 6894 bp deletion beginning at Chromosome 7 position 18,809,966 bp and ending after 18,816,859 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000676908, ENSMUSE00000198585, ENSMUSE00001284052, ENSMUSE00001300660 and ENSMUSE00000412301 (exons 1-5) and 2494 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. There is an 18 bp insertion AAGGCTCATCTACCAAAA at the deletion site.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories