| Primary Identifier | MGI:6849816 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dmwd |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCGTAGCCAACCAAACGCGA and TCTCGACCCCCAAAGTCAAG, which resulted in a 6894 bp deletion beginning at Chromosome 7 position 18,809,966 bp and ending after 18,816,859 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000676908, ENSMUSE00000198585, ENSMUSE00001284052, ENSMUSE00001300660 and ENSMUSE00000412301 (exons 1-5) and 2494 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. There is an 18 bp insertion AAGGCTCATCTACCAAAA at the deletion site. |
