| Primary Identifier | MGI:6849819 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rnf187 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGTCCTTGGAACCTGGTCA and ATAAGATTACTCATCCTGCA, which resulted in a 6959 bp deletion beginning at Chromosome 11 position 58,823,054 bp and ending after 58,830,012 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000590381, ENSMUSE00000105447, ENSMUSE00000105448 and ENSMUSE00000678141 (exons 1-4) and 5010 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. There is a 1 bp (T) insertion at the deletion site. |
