| Primary Identifier | MGI:6864483 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Kif1a |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 genome editing used guide RNAs (TCAATACGGAGTCTCGGTAA, GTCAATACGGAGTCTCGGTA, and TGTCAATACGGAGTCTCGGTA) to target exon 11. Donor DNAs were created encoding a P305L mutation (CCT to CTT, proline to leucine) and a silent mutation I304I (ATC to ATA) that introduces a Setl site. The P305L (proline to leucine) mutation was identified in children with KIF1A-associated neurological disorder (KAND), a neurodegenerative condition. |
