|  Help  |  About  |  Contact Us

Allele : Kif1a<em2Lutzy> kinesin family member 1A; endonuclease-mediated mutation 2, Cathy Lutz

Primary Identifier  MGI:6864483 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Kif1a
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 genome editing used guide RNAs (TCAATACGGAGTCTCGGTAA, GTCAATACGGAGTCTCGGTA, and TGTCAATACGGAGTCTCGGTA) to target exon 11. Donor DNAs were created encoding a P305L mutation (CCT to CTT, proline to leucine) and a silent mutation I304I (ATC to ATA) that introduces a Setl site. The P305L (proline to leucine) mutation was identified in children with KIF1A-associated neurological disorder (KAND), a neurodegenerative condition.
  • mutations:
  • Insertion,
  • Nucleotide substitutions
  • synonyms:
  • Kif1a<I304I,P305L>,
  • Kif1a<I304I,P305L>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele