|  Help  |  About  |  Contact Us

Allele : Rr213028<em1Hayus> regulatory region 213028; endonuclease-mediated mutation 1, Han-Yu Shih

Primary Identifier  MGI:7710909 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr213028
Is Recombinase  false Is Wild Type  false
molecularNote  The CTCF-binding site, between the Il22 and the Ifng topologically associating domains (TADs), was targeted with an sgRNA (equivalent to GCTAGTATGTGGCCACAAGA) using CRISPR/Cas9 technology, resulting in a 17 bp deletion (GRCm39:chr10:118206543-118206559).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • CBS-70delta,
  • CBS-70delta
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories