| Primary Identifier | MGI:6879445 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready | Gene | Rab39b |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 genome editing used guide RNAs upstream (GTATTTACTAAAGGACTGTC and CTAAAGGACTGTCAGGAATC) and downstream (ATGAGCCTTCTTCCTAGGCC and CCTGTCAGAGATCCAGGCCT) to target exon 2. Donor DNAs were created to insert loxP sites flanking exon 2. |
