|  Help  |  About  |  Contact Us

Allele : Rab39b<em6Lutzy> RAB39B, member RAS oncogene family; endonuclease-mediated mutation 6, Cathy Lutz

Primary Identifier  MGI:6879445 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready Gene  Rab39b
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 genome editing used guide RNAs upstream (GTATTTACTAAAGGACTGTC and CTAAAGGACTGTCAGGAATC) and downstream (ATGAGCCTTCTTCCTAGGCC and CCTGTCAGAGATCCAGGCCT) to target exon 2. Donor DNAs were created to insert loxP sites flanking exon 2.
  • mutations:
  • Insertion
  • synonyms:
  • Rab39b cKO,
  • Rab39b cKO
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele