|  Help  |  About  |  Contact Us

Allele : Tent5d<em1(IMPC)J> terminal nucleotidyltransferase 5D; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6879492 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tent5d
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGAATGCAAACATGTTCCC and TGGTATGATTGCTAAAAGTT, which resulted in a 3070 bp deletion beginning at Chromosome X position 107,870,055 bp and ending after 107,873,124 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000653984 (exon 6) and 455 bp of flanking intronic sequence including the splice acceptor and start site and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories