|  Help  |  About  |  Contact Us

Allele : Prkdc<em1Lutzy> protein kinase, DNA activated, catalytic polypeptide; endonuclease-mediated mutation 1, Cathy Lutz

Primary Identifier  MGI:6877105 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready Gene  Prkdc
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 genome editing is used to insert loxP sites flanking exon 5. Guide RNAs were selected to target upstream [ACTTTCCTATAACCCCAAGT ; CTTGGGAGTGACACCTACTT] and downstream [AAGTAGATTTAGATAAAACT ; AGTAGATTTAGATAAAACTT] of exon 5.
  • mutations:
  • Insertion
  • synonyms:
  • Prkdc flox exon5,
  • Prkdc flox exon5
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories