|  Help  |  About  |  Contact Us

Allele : Rragc<em1Efe> Ras-related GTP binding C; endonuclease-mediated mutation 1, Alejo Efeyan

Primary Identifier  MGI:6874615 Allele Type  Endonuclease-mediated
Attribute String  Hypomorph Gene  Rragc
Strain of Origin  Not Specified Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR-cas9 mediated recombination using a guide RNA (reverse orientation TCAAAGAAGTCCATCTGCCCAGG) introduced a CAG to CTC mutation, resulting in a Q119L mutation.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • RagC<Q119L>,
  • RagC<Q119L>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories