| Primary Identifier | MGI:6874618 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mir455 |
| Strain of Origin | (C57BL/6 x DBA/2)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 technology generated a 22-bp deletion (CTTTGGACTACATCGTGAACGC) that includes the miR-455-5p mature sequences. Neither miR-455-5p nor miR-455-3p are expressed in primary chondrocytes. Although miR-455 is located in intron 10 of Col27a1, expression of Col27a1 is not changed in chondrocytes indicating that Col27a1 is not affected by this deletion. |