|  Help  |  About  |  Contact Us

Allele : Ikzf3<em2Itan> IKAROS family zinc finger 3; endonuclease-mediated mutation 2, Ichiro Taniuchi

Primary Identifier  MGI:6885823 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ikzf3
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting TGGTGAACATCACATAATCT in exon 8) with CRISPR/Cas9 technology resulted in the insertion of an A into aspartic acid codon 461, causing a frameshift that eliminates zinc fingers 5 and 6 from the encoded peptide. The allele was created in fertilized eggs carrying the Ikzf3em1Itan allele.
  • mutations:
  • Insertion
  • synonyms:
  • Ikzf3<G158R:D461fs>,
  • Ikzf3<G158R:deltac-ZF>,
  • Ikzf3<G158R:deltac-ZF>,
  • Ikzf3<G158R:D461fs>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories