| Primary Identifier | MGI:6885823 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ikzf3 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using an sgRNA (targeting TGGTGAACATCACATAATCT in exon 8) with CRISPR/Cas9 technology resulted in the insertion of an A into aspartic acid codon 461, causing a frameshift that eliminates zinc fingers 5 and 6 from the encoded peptide. The allele was created in fertilized eggs carrying the Ikzf3em1Itan allele. |
