|  Help  |  About  |  Contact Us

Allele : B4galt1<em1Gidg> UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1; endonuclease-mediated mutation 1, Giusy Della Gatta

Primary Identifier  MGI:6886193 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  B4galt1
Transmission  Germline Strain of Origin  C57BL/6NTac
Is Recombinase  false Is Wild Type  false
molecularNote  Using an sgRNA (targeting GAGGACGTACCTCTGAGGATTGG) and an ssODN template (ATGCTGTAGTAGGGAGGTGTCGAATGATCCGGCATTCAAGAGACAAGAAAAATGAGCCCAGTCCCCAGAGGTACGTCCTCTCTGTGCCTTCCCTTTATTTATTTATATGTTAGATTTATTT) with CRISPR/Cas9 technology, asparagine codon 353 (AAT) was changed to serine (AGT)(p.N353S). This mimics the human p.Asn352Ser mutation associated with protein glycosylation defects.
  • mutations:
  • Single point mutation
  • synonyms:
  • B4galt1 Asn353Ser knock-in,
  • B4galt1 Asn353Ser knock-in,
  • B4galt1 353Ser,
  • B4galt1 353Ser
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories