|  Help  |  About  |  Contact Us

Allele : P2rx2<em1Xzl> purinergic receptor P2X, ligand-gated ion channel, 2; endonuclease-mediated mutation 1, Xue Zhong Liu

Primary Identifier  MGI:6886215 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  P2rx2
Inheritance Mode  Dominant Strain of Origin  CBA/J
Is Recombinase  false Is Wild Type  false
molecularNote  Using sgRNA (targeting GCACGATGAAGACGTACCTG) and an ssODN template with CRISPR/Cas9 technology, valine codon 61 (GTC) in exon 2 was changed to leucine (CTC) (c.181G>C, p.V61L). This mutation mimics the human p.V60L mutation associated with a form of dominant early-onset progressive sensorineural hearing loss (DFNA41).
  • mutations:
  • Single point mutation
  • synonyms:
  • P2rx2 KI,
  • P2rx2 p.V61L,
  • P2rx2 p.V61L,
  • P2rx2 KI,
  • P2rx2 c.179G>C,
  • P2rx2 c.179G>C
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories