| Primary Identifier | MGI:6886215 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | P2rx2 |
| Inheritance Mode | Dominant | Strain of Origin | CBA/J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Using sgRNA (targeting GCACGATGAAGACGTACCTG) and an ssODN template with CRISPR/Cas9 technology, valine codon 61 (GTC) in exon 2 was changed to leucine (CTC) (c.181G>C, p.V61L). This mutation mimics the human p.V60L mutation associated with a form of dominant early-onset progressive sensorineural hearing loss (DFNA41). |
