|  Help  |  About  |  Contact Us

Allele : Brcc3<em1Bfpy> BRCA1/BRCA2-containing complex, subunit 3; endonuclease-mediated mutation 1, Benedicte F Py

Primary Identifier  MGI:7254894 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Brcc3
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using a crRNA (AGUGAUGGGUCUGUGUAUAGGUUUUAGAGCUAUGCUGUUUUG) with CRISPR/Cas9 technology, a 2 bp deletion (TA) was created in the coding region of exon 1, causing a frameshift and premature stop codon.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Brcc3<->,
  • Brcc3<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories