|  Help  |  About  |  Contact Us

Allele : Lmna<em1Yuzha> lamin A; endonuclease-mediated mutation 1, Yu Zhang

Primary Identifier  MGI:7431464 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Lmna
Strain of Origin  Not Specified Is Recombinase  false
Is Wild Type  false
molecularNote  The BE4-Gam gene editing system using sgRNA GTGGGCGGATCCATCTCCTC was used to introduce a C to T change at position 1827 (c.1827C>T) resulting in a glycine to glycine substitution at codon 609 (p.G609G). This corresponds to the c.1824C>T, p.G608G dominant mutation seen in over 90% of cases with Hutchinson-Gilford progeria syndrome, which activates a cryptic splice site in exon 11 and produces a truncated laminin A which remains farnesylated.
  • mutations:
  • Single point mutation
  • synonyms:
  • Lmna<G609G>,
  • Lmna<G609G>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories