| Primary Identifier | MGI:7431464 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Lmna |
| Strain of Origin | Not Specified | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The BE4-Gam gene editing system using sgRNA GTGGGCGGATCCATCTCCTC was used to introduce a C to T change at position 1827 (c.1827C>T) resulting in a glycine to glycine substitution at codon 609 (p.G609G). This corresponds to the c.1824C>T, p.G608G dominant mutation seen in over 90% of cases with Hutchinson-Gilford progeria syndrome, which activates a cryptic splice site in exon 11 and produces a truncated laminin A which remains farnesylated. |
