|  Help  |  About  |  Contact Us

Allele : Cyp2w1<em1(IMPC)J> cytochrome P450, family 2, subfamily w, polypeptide 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7413932 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cyp2w1
Inheritance Mode  Not Specified Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCCCTAGTACCAATCCAAG and GCCCACTCCAGGTATTCACA, which resulted in a 1837 bp deletion beginning at Chromosome 5 position 139,354,049 bp and ending after 139,355,885 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000189900, ENSMUSE00000391270, and ENSMUSE00000685698 (exons 3,4, and 5) and 1355 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 117 and early truncation 1 amino acid later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories