|  Help  |  About  |  Contact Us

Allele : Slc26a4<em1Chch> solute carrier family 26, member 4; endonuclease-mediated mutation 1, Chen-Chi Wu

Primary Identifier  MGI:6890464 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Slc26a4
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting AAAGGACAGATTCTTTCTGA) and an ssODN template with CRISPR/Cas9 technology, threnonine codon 721 (ACG) in exon 15 was changed to methionine (ATG) (c.2162C>T, p.T721M); also, two silent mutations were introduced to create a diagnostic HinfI restriction site. This mutation mimics a human mutation associated with sensorineural hearing impairment (SNHI) but doesn't cause deafness in mouse.
  • mutations:
  • Single point mutation
  • synonyms:
  • Slc26a4<T721M>,
  • Slc26a4<T721M>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories