|  Help  |  About  |  Contact Us

Allele : Ect2l<em1(IMPC)J> epithelial cell transforming sequence 2 oncogene-like; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7432300 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ect2l
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACCAGGAAAAGGCTTAAA and GCTGGGTAAGTGTCTCAAGG, which resulted in a 499 bp deletion beginning at Chromosome 10 position 18,173,871 bp and ending after 18,174,369 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000615953 (exon 4) and 246 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 126 and early truncation 10amino acids later. There is a 4 bp insertion at the deletion site (TGAA).
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories