|  Help  |  About  |  Contact Us

Allele : Mlh3<em1Jcs> mutL homolog 3; endonuclease-mediated mutation 1, John C Schimenti

Primary Identifier  MGI:7276200 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Mlh3
Strain of Origin  FVB/NJ x B6(Cg)-Tyr<c-2J>/J Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting GCAAGTATAGCCGACATGGC) and an ssODN template (AGCATTTTATGGCTTCGGAGGAGAGGCCTTGGCAAGTATAGCCGACATGGCTGGTGCTGTGGAGATTTCATCCAAGAAAAACACAACACTGAAAA) with CRISPR/Cas9 technology, arginine codon 93 (CGA) was changed to glycine (GGA) (c.277C>G, p.R93G).
  • mutations:
  • Single point mutation
  • synonyms:
  • Mlh3<R93G>,
  • Mlh3<R93G>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele