|  Help  |  About  |  Contact Us

Allele : Mlh3<em2Jcs> mutL homolog 3; endonuclease-mediated mutation 2, John C Schimenti

Primary Identifier  MGI:7276201 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Mlh3
Strain of Origin  FVB/NJ x B6(Cg)-Tyr<c-2J>/J Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting GCTCCAAACGAATGCGTTCA) and an ssODN template (CTTAAATCTCCTCTAACTACAGACAGATACTTACCAGTAATAAGCTGCTCCAAACGTATGTGTTCATGTGCAGCATGCTGGTCCACCAGGACTAACAGGTTTCCACCTACAAAATAATCC) with CRISPR/Cas9 technology, arginine codon 1192 (CGC) was changed to histidine (CAC) (c.3575G>A, p.R1192H). This is the equivalent of the human p.R1230H mutation.
  • mutations:
  • Single point mutation
  • synonyms:
  • Mlh3<R1230H>,
  • Mlh3<R1230H>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories