| Primary Identifier | MGI:7276201 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Mlh3 |
| Strain of Origin | FVB/NJ x B6(Cg)-Tyr<c-2J>/J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using an sgRNA (targeting GCTCCAAACGAATGCGTTCA) and an ssODN template (CTTAAATCTCCTCTAACTACAGACAGATACTTACCAGTAATAAGCTGCTCCAAACGTATGTGTTCATGTGCAGCATGCTGGTCCACCAGGACTAACAGGTTTCCACCTACAAAATAATCC) with CRISPR/Cas9 technology, arginine codon 1192 (CGC) was changed to histidine (CAC) (c.3575G>A, p.R1192H). This is the equivalent of the human p.R1230H mutation. |
