| Primary Identifier | MGI:7711614 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready, Inserted expressed sequence, Reporter | Gene | Gt(ROSA)26Sor |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | sgRNAs (ACTGGAGTTGCAGATCACGA and GCAGATCACGAGGGAAGAGG) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette containing 3xSV40 polyadenlyation signals, an EGFP sequence, a viral 2A oligopeptide (P2A) self-cleaving peptide, that mediates ribosomal skipping, and a mutant phenylalanyl-tRNA synthetase, alpha subunit (Farsa) gene into the Gt(ROSA)26Sor locus. The Farsa gene contains a threonine to glycine mutation at amino acid 413 (T413G). |