|  Help  |  About  |  Contact Us

Allele : Gt(ROSA)26Sor<em2(CAG-GFP,-Farsa*T413G)Msasn> gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 2, Michael Sasner

Primary Identifier  MGI:7711614 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready, Inserted expressed sequence, Reporter Gene  Gt(ROSA)26Sor
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  sgRNAs (ACTGGAGTTGCAGATCACGA and GCAGATCACGAGGGAAGAGG) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette containing 3xSV40 polyadenlyation signals, an EGFP sequence, a viral 2A oligopeptide (P2A) self-cleaving peptide, that mediates ribosomal skipping, and a mutant phenylalanyl-tRNA synthetase, alpha subunit (Farsa) gene into the Gt(ROSA)26Sor locus. The Farsa gene contains a threonine to glycine mutation at amino acid 413 (T413G).
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

1 Expresses

Trail: Allele

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele