| Primary Identifier | MGI:7711743 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr513 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Pax1 enhancer PEC7 was targeted using sgRNAs (equivalent to ACTCATTTGCCAAGACCCATGGG and TGATACTGTCCATAAACCTCAGG) with CRISPR/Cas9 technology, resulting in ~5.8 kb deletions. Three strains were produced with the following deletions: GRCm39:chr2:147404882-147410717 (64-C, 67-C), 147404883-147410707 (70-E). |